the last monster here for this island & he got a super drastic redesign lol. its really funny looking back at this guy bcus i somehow managed to predict the paironormal symbol, like down to the colours & everything Info: Name: Turvarop Class: Seasonal Elements: Re:Versary (Opposite Day) Instruments: Reversed Piano Grid Size: 3x3 Section of their sequenced genome: TTATGGTTTGGACCTGCGGCGGTTCCAGACCG Bio: The representative of Re:Versary has made itself known! Turvarop is a living paradox; it's existence is stuck between two polar opposites. It's shadow glows white, limbs are in the wrong places & it's irises are inside the pupils. It seems to emit a field of inversion, completely flipping everything it in upside down. This inversion field is put to particularly great use during Re:Versary. Monsters are flipped sideways, painted their opposite colours & it's overall just meant to be a silly event! We hope this thing doesn't ever realise the potential of its power because it could very easily destroy the entire monster universe please don't find out please please please please please pl"
youtube version: https://www.youtube.com/watch?v=a3gFla31F2k