This is a project I made for school. READ THIS BEFOREHAND ———————————————————— This is an algorithm that encode and decode information the same way DNA in your cells can. When you encode a message, it will return the DNA gene as it would look like in your cells. ———————————————————— The DNA gene will be translated into messenger, RNA and then into RNA, after that, it will be translated into a set of letters ———————————————————— Wanna know how it works? Press the [SEE INSIDE] button (top right corner). The reason I chose the scratch coding language because of its simple and understandable syntax. I highly recommend going through and reading my notes ———————————————————— If you want a sample code to try, use this one: GAATAGAAACTTACTTAGAGCATTCCTGCCCTTCGATGC
how do i do it?? ———————————————————— press [E] to encode a short phrase or sentence (this will return several base pairs) press [T] to translate DNA genes into English (this will return the final phrase) IMPORTANT!! the "ø" symbol marks a letter that you used that is not in the translatable database - marked with a XXX codon Also, if you try to translate real genes in the human body, it will return gibberish, because genes in human body are meant to code for proteins and not English If you find any bugs or glitches, feel free to comment them below Thanks and enjoy!
